Review



slide scanning microscope motic easyscan pro  (Motic Group)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Motic Group slide scanning microscope motic easyscan pro
    Slide Scanning Microscope Motic Easyscan Pro, supplied by Motic Group, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slide+scanning+microscope+motic+easyscan+pro/slide+scanner+motic+easyscan+digital+slide+scanner/pm39761726-270-17-20
    Average 90 stars, based on 1 article reviews
    slide scanning microscope motic easyscan pro - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Staining:

    Article Title: In Vivo CRISPR Activation Screening Reveals Chromosome 1q Genes VPS72, GBA1, and MRPL9 Drive Hepatocellular Carcinoma.
    Article Snippet: .. Stained sections were imaged using a light microscope (Zeiss, Oberkochen, Germany Primo Star) or scanned with a slide scanning microscope (Motic EasyScan Pro). .. For transgenemediated overexpression, T226 cells were transfected with 0.1 mg Myc-Zbtb7b, Myc-Vps72, or Myc-Gfp control at a Table 3.Primers for qPCR Experiments of Mouse Genes Gene target Sense Forward (50-30) Vps72 Fwd AACTTACGGGGGTTTCACCG Rev GCTCTTCCGCTTCTCCATCAC Gba Fwd GCCAGGCTCATCGGATTCTTC Rev GAGTGCTCTCGTAACGGCT Mrpl9 Fwd CCGCGAATTGAAGGGAGTACC Rev CCTCCACCAACTTATACACGC Zbtb7b Fwd CCCGAGGATGACCTGATTGG Rev CCTGCGTCCTGATGGTGAG Gapdh Fwd AGGTCGGTGTGAACGGATTTG Rev TGTAGACCATGTAGTTGAGGTCA 2343 2344 2345 FLA 5.7.0 DTD JCMGH101460 proof 1014 3:1 (transfection reagent: DNA) ratio (Promega, Madison, WI, #E2311) or transduced with lentiviral vectors expressing Mrpl9, Gba1, or Gfp control.

    Light Microscopy:

    Article Title: In Vivo CRISPR Activation Screening Reveals Chromosome 1q Genes VPS72, GBA1, and MRPL9 Drive Hepatocellular Carcinoma.
    Article Snippet: .. Stained sections were imaged using a light microscope (Zeiss, Oberkochen, Germany Primo Star) or scanned with a slide scanning microscope (Motic EasyScan Pro). .. For transgenemediated overexpression, T226 cells were transfected with 0.1 mg Myc-Zbtb7b, Myc-Vps72, or Myc-Gfp control at a Table 3.Primers for qPCR Experiments of Mouse Genes Gene target Sense Forward (50-30) Vps72 Fwd AACTTACGGGGGTTTCACCG Rev GCTCTTCCGCTTCTCCATCAC Gba Fwd GCCAGGCTCATCGGATTCTTC Rev GAGTGCTCTCGTAACGGCT Mrpl9 Fwd CCGCGAATTGAAGGGAGTACC Rev CCTCCACCAACTTATACACGC Zbtb7b Fwd CCCGAGGATGACCTGATTGG Rev CCTGCGTCCTGATGGTGAG Gapdh Fwd AGGTCGGTGTGAACGGATTTG Rev TGTAGACCATGTAGTTGAGGTCA 2343 2344 2345 FLA 5.7.0 DTD JCMGH101460 proof 1014 3:1 (transfection reagent: DNA) ratio (Promega, Madison, WI, #E2311) or transduced with lentiviral vectors expressing Mrpl9, Gba1, or Gfp control.

    Microscopy:

    Article Title: In Vivo CRISPR Activation Screening Reveals Chromosome 1q Genes VPS72, GBA1, and MRPL9 Drive Hepatocellular Carcinoma.
    Article Snippet: .. Stained sections were imaged using a light microscope (Zeiss, Oberkochen, Germany Primo Star) or scanned with a slide scanning microscope (Motic EasyScan Pro). .. For transgenemediated overexpression, T226 cells were transfected with 0.1 mg Myc-Zbtb7b, Myc-Vps72, or Myc-Gfp control at a Table 3.Primers for qPCR Experiments of Mouse Genes Gene target Sense Forward (50-30) Vps72 Fwd AACTTACGGGGGTTTCACCG Rev GCTCTTCCGCTTCTCCATCAC Gba Fwd GCCAGGCTCATCGGATTCTTC Rev GAGTGCTCTCGTAACGGCT Mrpl9 Fwd CCGCGAATTGAAGGGAGTACC Rev CCTCCACCAACTTATACACGC Zbtb7b Fwd CCCGAGGATGACCTGATTGG Rev CCTGCGTCCTGATGGTGAG Gapdh Fwd AGGTCGGTGTGAACGGATTTG Rev TGTAGACCATGTAGTTGAGGTCA 2343 2344 2345 FLA 5.7.0 DTD JCMGH101460 proof 1014 3:1 (transfection reagent: DNA) ratio (Promega, Madison, WI, #E2311) or transduced with lentiviral vectors expressing Mrpl9, Gba1, or Gfp control.



    Similar Products

    slide scanning microscope motic easyscan pro  (Motic Group)
    90
    Motic Group slide scanning microscope motic easyscan pro
    Slide Scanning Microscope Motic Easyscan Pro, supplied by Motic Group, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/slide+scanning+microscope+motic+easyscan+pro/slide+scanner+motic+easyscan+digital+slide+scanner/pm39761726-270-17-20
    Average 90 stars, based on 1 article reviews
    slide scanning microscope motic easyscan pro - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results